Egr1 chip seq
WebIn this paper, we performed a ChIP-Seq experiment to find the targeting microRNA genes of a transcription factor, Egr1, in human erythroleukemia cell line K562. We found Egr1 binding sites near the promoters of 124 distinct microRNA genes, accounting for about 42% of the miRNAs which have high-confidence predicted promoters (294). WebOct 1, 2024 · The most significantly highly expressed TFs in M1 and M2 macrophages were identified by RNA-seq as Irf1 and Egr1, with LogFC values of 3.2 and 2.8, respectively. …
Egr1 chip seq
Did you know?
WebChIP-Seq demonstrated that EGR1 globally increases miRNA expression in K562 cells stimulated with PMA [32]. EGR1 was increased in the patient data set (Figure 5A). ... WebThe Township of Fawn Creek is located in Montgomery County, Kansas, United States. The place is catalogued as Civil by the U.S. Board on Geographic Names and its elevation …
WebJan 13, 2024 · To assess whether EGR1 and NuRD functionally associate at chromatin in macrophages, we performed CHD4 ChIP-seq at day 4 of … WebThe cut-off values for high-throughput sequencing and qPCR were FDR < 0.05 and P < 0.05, respectively. Results: Conclusions: Through multiomic analyses of epigenetic sequencing and RNA-seq with partial validation, the current study found that Irf1- and Egr1-induced transcription plays key roles in M1 and M2 macrophage polarization, …
WebInformation for Egr1(Zf)/K562-Egr1-ChIP-Seq(GSE32465)/Homer (Motif 79) C A G T T C A G G A T C A C T G A C G T C T A G A C T G A C T G G A C T C T A G Reverse … WebJul 11, 2024 · Furthermore, RNA sequencing of renal TECs, Chromatin Immunoprecipitation (ChIP) assay, and Dual-luciferase reporter assay were carried out to investigate whether EGR1 affects the expression of SOX9. Results: EGR1 is highly expressed in the kidney after AKI both in humans and mice through analysis of the Gene …
http://homer.ucsd.edu/homer/motif/HomerMotifDB/homerResults/motif79.info.html
WebMar 21, 2024 · EGR1 (Early Growth Response 1) is a Protein Coding gene. Diseases associated with EGR1 include Ischemia and Monocytic Leukemia. Among its related pathways are PIP3 activates AKT signaling and Hepatocyte growth factor receptor signaling. ... Cistromic (ChIP-Seq) regulation report from SPP (The Signaling Pathways Project) for … bloxburg exterior ideas 1 storyhttp://homer.ucsd.edu/homer/motif/HomerMotifDB/homerResults/motif79.info.html free fisma courseWebOct 2, 2024 · The locations of the ChIP primers for each putative regulatory sub-region of EGR are indicated by arrows in the panel. b ChIP-qPCR analyses of H3K27me3, H3K4me1, H3K4me3, and EZH2 at the EGR1... bloxburg exterior color schemesWebTranscription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed into RNA molecules that can encode proteins are said to produce messenger RNA (mRNA). Other segments of DNA … bloxburg expensive housesWebIn this paper, we performed a ChIP-Seq experiment to find the targeting microRNA genes of a transcription factor, Egr1, in human erythroleukemia cell line K562. We found Egr1 … free fish templates printableWebInformation for Egr1(Zf)/K562-Egr1-ChIP-Seq(GSE32465)/Homer (Motif 79) CAGTTCAGGATCACTGACGTCTAGACTGACTGGACTCTAG Reverse Opposite:GATCCTGAAGTCTGACAGTCGTCAAGTCCTAGAGTCGTCA Matches to Known Motifs Egr1(Zf)/K562-Egr1-ChIP-Seq(GSE32465)/Homer … bloxburg exterior ideas youtubeWebMay 24, 2024 · Hello, I Really need some help. Posted about my SAB listing a few weeks ago about not showing up in search only when you entered the exact name. I pretty … bloxburg exterior inspo